Department of Biotechnology

Indian Institute of Technology Hyderabad (IITH) is a premier institute of science and technology established in 2008. IITH has been consistently ranked in the&nbsp;<a href="https://iith.ac.in/reports/" rel="noopener noreferrer">top 10 institutes</a>&nbsp;in India for Engineering&nbsp;<a href="https://www.nirfindia.org/2021/EngineeringRanking.html" rel="noopener noreferrer" target="_blank">according to NIRF</a>&nbsp;making it one of the most coveted schools for science and technology in the country.

IITH offers&nbsp;<a href="https://iith.ac.in/academics/under-graduate/">undergraduate programs</a>&nbsp;in all the classical engineering disciplines, applied sciences, design, as well as several modern interdisciplinary areas. Students are given a flexibility to explore a broad set of areas, and potentially pursue a minor or double major in a discipline that is not their own. Students who wish to seek a deeper understanding of their own discipline are strongly encouraged to get involved in cutting-edge research with the help of a faculty to mentor them, and earn an Honors in their own field.

The very foundation of IIT Hyderabad is based on&nbsp;<a href="https://iith.ac.in/research/">research and innovation</a>. The vibrant research culture is evident from the number of patents and publications that IITH produces consistently every year. IITH offers&nbsp;<a href="https://iith.ac.in/academics/programmes-offered/">graduate programs</a>&nbsp;at both a masters, and a doctoral level, in several diverse areas. There are separate programs for technology, design, science, and liberal arts. The&nbsp;<a href="https://iith.ac.in/academics/post-graduate/">MTech program</a>&nbsp;is offered in various modes and durations to cater to the ever-growing need of postgraduate level professionals in the country.

IITH encourages and supports&nbsp;<a href="https://iic-iith.netlify.app/index.html" rel="noopener noreferrer" target="_blank">innovation and entrepreneurship</a>&nbsp;at every stage. The minor program in entrepreneurship is open to all students of IITH, and many of the courses are offered by industrialists who are entrepreneurs themselves. There are various&nbsp;<a href="https://iith.ac.in/research/centres-incubators/">innovation centers and incubators</a>&nbsp;that promote entrepreneurship and help mentor young innovators. IITH has been very successful in building tie-ups with leading academic institutions around the globe.

IITH enjoys a very special relationship with Japanese universities and industries that goes beyond academic and research collaborations. In fact, some of the iconic buildings in IITH campus will carry the signature of Japanese architecture.

IITH creates a unique holistic ecosystem for education that offers interactive learning, a very flexible academic structure, cutting-edge research, strong industry collaboration, and entrepreneurship. This is an environment which enables students and faculty to translate their dreams into realities.

IIT Hyderabad

The present study is designed to evaluate the potential of deoiled algal biomass (DAB) residue as an alternative resource for the production of bioethanol and biopolymers in a biorefinery approach. Hybrid pretreatment method resulted in higher sugar solubilization (0.590 g/g DAB) than the corresponding individual physicochemical (0.481 g/g DAB) and enzymatic methods (0.484 g/g DAB). Subsequent utilization of sugars from hybrid pretreatment for bioethanol using Saccharomyces cerevisiae resulted in maximum bioethanol production at pH 5.5 (0.145 ± 0.008 g/g DAB) followed by pH 5.0 (0.122 ± 0.004 g/g DAB) and pH 6.0 (0.102 ± 0.002 g/g DAB). The experiments for biopolymer (PHB: polyhydroxybutyrate) production resulted in 0.43 ± 0.20 g PHB/g DCW. Extracted polymer on NMR and FT-IR analysis showed the presence of PHB. Exploration of DAB as an alternative renewable resource for multiple biobased products supports sustainability and also enables entirety use of DAB by addressing the DAB-residue allied disposal issues. © 2019 Elsevier Ltd

World University root node

Fulltext

Bioresource Technology

Deoiled algal biomass derived renewable sugars for bioethanol and biopolymer production in biorefinery framework

The mounting food waste (FW) being globally generated is a massive concern that needs to be effectively mitigated to safeguard environment. FW treatment is one of the prime focus areas wherein different physical, chemical, or hybrid pretreatment technologies have been adopted to depolymerize the complex waste matrix composed of starch, cellulose, hemicellulose, proteins, and lipids to sustainable chemicals and fuels. However, significant level of undesired products formed during conventional pretreatment has urged for a more benign approach such as enzymatic treatment. Enzymes are substrate specific compared with other nonspecific pretreatment methods and mostly result in the formation of single product for each enzyme type. Industrial hydrolytic enzymes such as amylases, cellulases, xylanases, lipases, and proteases possess myriad commercial applications and occupy major share in the world market for enzymes. The possibility to use these enzymes for FW treatment is being ventured since the recent past with a vision to valorize FW along with waste remediation. Enzymes are being targeted as catalysts for FW treatment due to higher productivity, lower concentration of inhibitory by-products, mild operating conditions, lower water requirement, no major pH neutralization/washing of treated waste, and less toxic outlet streams. With this backdrop the current chapter comprehensively presents FW statistics in global context and reflects the relevance of enzymatic interventions in FW valorization. The factors effecting enzyme-mediated FW treatment along with solid-state and submerged fermentation strategies for FW bioconversion are discussed in details. Therefore this chapter showcases the application of enzymes in FW processing for revenue generation in an ecofriendly manner. © 2021 Elsevier Inc. All rights reserved.

Current Developments in Biotechnology and Bioengineering: Sustainable Food Waste Management: Resource Recovery and Treatment

Bioconversion Technologies: Hydrolytic Enzyme Treatment of Food Waste

Feedstock availability and its pretreatment, high process economics and insufficient ethanol (HEt) titres necessitated the bioprocesses that are sustainable. The advanced consolidated bioprocessing (CBPSeq) strategy presently considered for improved HEt production involves, sequential coupling of CBP thermophile, Clostridium thermocellum ATCC-27405 with mesophilic microaerobe, Pichia stipitis NCIM-3498. Biogenic municipal solid waste (BMSW) pretreated with 0.5% NaOH (CSPBMSW) served as the sole carbon source. CBPSeq (23.99 g/L) fared better than CBP standalone (18.10 g/L) wherein 1.32-folds improvement in HEt titre was recorded. Considering insufficient xylanase titre in cellulosome complex of C. thermocellum, CBPSeq was performed employing exogenous xylanases (CBPSeqE) to improve xylan digestibility and HEt yield. CBPSeqE-II biosystem at pH 5 showed maximum HEt titre of 36.90 g/L which corresponds to yield of 0.26 g HEt/ g CSPBMSW. This study substantiates efficacy of CBPSeqE-II biosystem in sustainable bioethanol production from BMSW in a single reactor without laborious steps. © 2020 Elsevier Ltd

Sequential and consolidated bioprocessing of biogenic municipal solid waste: A strategic pairing of thermophilic anaerobe and mesophilic microaerobe for ethanol production

Objective: Severe aortoiliac occlusive disease is a relative contraindication for endovascular aneurysm repair, owing to an association with high stent graft-related complication and reintervention rates in this population. Open AAA repair requiring aortofemoral bypass (AFB), however, may represent a unique population with differing outcomes from standard open repair. We sought to compare the demographic and procedural characteristics, as well as outcomes of patients undergoing standard intra-abdominal repairs (STD) versus those requiring AFB. Methods: Using a prospectively maintained database, we retrospectively identified patients who underwent open AAA repair from 1994 to 2017. A total of 1087 consecutive cases were performed consisting of 981 STD (681 tube graft, 300 aortoiliac) and 106 AFB cases. Demographics, procedural data, postoperative complications, and long-term survival were analyzed. Results: The AFB cohort had more women (39.0 vs 22.8%; P =.001) and higher rates of hypertension (81.1 vs 69.8%; P =.015), chronic obstructive pulmonary disease (28.3 vs 17.4%; P =.006), and smoking (50.9 vs 36%; P =.002). The AFB group had smaller mean aortic (5.22 vs 5.77 cm; P =.001) and graft (17.08 vs 18.2 mm; P =.001) diameters. Proximal clamp position and blood loss were equivalent, although total anesthesia time was longer (295 vs 234 minutes; P =.001) in the AFB cohort. Overall 30-day postoperative morbidity (38.7 vs 24.8%; P =.002) was higher in the AFB group. Specifically, postoperative renal insufficiency (8.2 vs 3.4%; P =.032), wound infection (5.7 vs 1.2%; P =.005), and hematoma/seroma (5.7 vs 1.2%; P =.003) were more likely. Hospital length of stay was longer for AFB (11.9 vs 9.9 days; P =.007). The 30-day mortality (0.9% AFB vs 1.8% STD; P =.50) and major morbidity (17 vs 11.5%; P =.10) did not differ. Reintervention rate within 30 days of the initial surgery (12.3 vs 4.6; P =.001) and overall (33 vs 18.9%; P =.001) was higher in the AFB group. Long-term survival was lower in the AFB group (5-year survival: 63.1% AFB vs 71.9% STD; hazard ratio 0.76, log-rank P =.047). Multivariate regression analysis identified age, comorbid conditions, and aneurysm characteristics—rather than repair type—as independent predictors of 30-day reintervention and mortality at 5 years. Conclusions: Patients requiring AFB for AAA owing to associated iliac occlusive disease have more preoperative comorbidities, postoperative complications, a longer length of stay, reintervention rates and shorter 5-year survival. Patient and aneurysm characteristics rather than surgical repair type appear to be responsible for these differences. Nevertheless, 30-day mortality and major morbidity were comparable, making AFB an attractive alternative to endovascular aneurysm repair in patients with advanced iliac occlusive disease. © 2019 Society for Vascular Surgery

Journal of Vascular Surgery

The impact of combined iliac occlusive disease and aortic aneurysm on open surgical repair

The gammaproteobacterium Marinobacter hydrocarbonoclasticus NCT7M was cultivated from the copepod Acartia tonsa, collected from the coastal western North Atlantic Ocean. The genome was assembled into 45 contigs for a total of 4,128,590 bp, a GC content of 57.3%, and 3,890 protein-coding genes. The genome contains the full gene cluster for denitrification. Copyright © 2020 Nuttall et al. This is an open-access article distributed under the terms of the Creative Commons Attribution 4.0 International license.

Microbiology Resource Announcements

Draft Genome Sequence of Marinobacter hydrocarbonoclasticus NCT7M, Obtained from the Microbiome of a Marine Copepod

Polypyridyl backbone nitrosyl complexes of ruthenium with the molecular framework [RuII(antpy)(bpy)NO+/]n+ [4](PF6)3 (n = 3), [4](PF6)2 (n = 2), where antpy = 4′-(anthracene-9-yl)-2,2′:6′,2′′-terpyridine and bpy = 2,2′-bipyridine, were synthesized via a stepwise synthetic route from the chloro precursor [RuII(antpy)(bpy)(Cl)](PF6) [1](PF6) and [RuII(antpy)(bpy)(CH3CN)](PF6)2 [2](PF6)2 and [RuII(antpy)(bpy)(NO2)](PF6) [3](PF6). After column chromatographic purification, all the synthesized complexes were fully characterized using different spectroscopic and analytical techniques including mass spectroscopy, 1H NMR, FT-IR and UV-vis spectrophotometry. The Ru-NO stretching frequency of [4](PF6)3 was observed at 1941 cm-1, which suggests moderately strong Ru-NO bonding. A massive shift in the νNO frequency occurred at Δν = 329 cm-1 (solid) upon reducing [4](PF6)3 to [4](PF6)2. To understand the molecular integrity of the complexes, the structure of [3](PF6) was successfully determined by X-ray crystallography. The redox properties of [4](PF6)3 were thoroughly investigated together with the other precursor complexes. The rate constants for the first-order photo-release of NO from [4](PF6)3 and [4](PF6)2 were determined to be 8.01 × 10-3 min-1 (t1/2 ∼ 86 min) and 3.27 × 10-2 min-1 (t1/2 ∼ 21 min), respectively, when exposed to a 200 W Xenon light. Additionally, the photo-cleavage of Ru-NO occurred within ∼2 h when [4](PF6)3 was irradiated with an IR light source (&gt;700 nm) at room temperature. The first-order rate constant of 9.4 × 10-3 min-1 (t1/2 ∼ 73 min) shows the efficacy of the system and its capability to release NO in the photo-therapeutic window. The released NO triggered by light was trapped by reduced myoglobin, a biologically relevant target protein. The one-electron reduction of [4](PF6)3 to [4](PF6)2 was systematically carried out chemically (hydrazine hydrate), electrochemically and biologically. In the biological reduction, it was found that the reduction is much slower with double-stranded DNA compared to a single-stranded oligonucleotide (CAAGGCCAACCGCGAGAAGATGAC). Moreover, [4](PF6)3 exhibited significant photo-toxicity to the VCaP prostate cancer cell line upon irradiation with a visible light source (IC50 ∼ 8.97 μM). This journal is © The Royal Society of Chemistry.

Department of Chemistry

Dalton Transactions

Near-IR light-induced photorelease of nitric oxide (NO) on ruthenium nitrosyl complexes: Formation, reactivity, and biological effects

Investigation of microbial communities in the indoor environment is critically important as majority of human life is spent indoors. Airborne microbial flora and their pyrogenic substances can impact human health. They have so far been insufficiently characterized. Here, we quantify bioaerosol concentration and diversity in both indoor and outdoor air of rural households in South India and statistically determine the significant predictor variables influencing them. The median concentration of bacterial and fungal aerosols in indoor air (n = 36 households) was 1031 colony forming units (CFU) m−3 and 580 CFU m−3, respectively, and in outdoor air was 742 CFU m−3 and 680 CFU m−3, respectively. Bacterial species were comprised of the four major phyla Actinobacteria, Firmicutes, Proteobacteria, and Bacteroidetes, and fungal species of Ascomycota, Basidiomycota, and Zygomycota, in both indoor and outdoor air. Multivariable linear regression revealed that outdoor bacterial concentration, the number of house inhabitants, indoor temperature, age of the homes and use of biomass (cow dung or firewood) as cooking fuel were significant predictor variables influencing concentrations of bacteria in the indoor air. The significant predictor variables influencing indoor endotoxin concentrations were indoor bacterial concentration, indoor meteorology (temperature and relative humidity), and use of biomass as cooking fuel. Outdoor fungal concentration was the significant predictor variable influencing fungal concentration in indoor air. Endotoxin concentrations in indoor air ranged from 1.23 to 20.7 EU m−3. Quantitative microbial risk assessment (QMRA) model revealed a probability of infection of resident women from B. anthracis to be 0.0009 to 0.010. © 2020 Elsevier Ltd

Department of Civil Engineering

Building and Environment

Ambient concentration of airborne microbes and endotoxins in rural households of southern India

Glyphosate, an herbicide used worldwide, has emerged as a pollutant. However, its toxic effects are debated by regulatory authorities. Therefore, it is essential to keep the use of such chemicals under continuous observation, and their effects must be re-evaluated. We used zebrafish embryos to evaluate the toxic effects of glyphosate and its mechanisms. We found that glyphosate induced significant toxicity in a time and concentration-dependent manner. We observed an LD 50 of 66.04 ± 4.6 μg/mL after 48 h of exposure. Glyphosate significantly reduced the heartbeat in a time and concentration-dependent manner indicating cardiotoxicity. Selective downregulation of Cacana1C (L-type calcium channel) and ryr2a (Ryanodine receptor) genes along with selective upregulation of hspb11 (heat shock protein) gene was observed upon exposure to glyphosate indicating alterations in the calcium signaling. A reduction in the nitric oxide (NO) generation was also observed in the zebrafish embryos upon exposure to glyphosate. Our results indicate that glyphosate induces significant toxicity including cardiotoxicity in zebrafish embryos in a time and concentration-dependent manner. Further, cardiotoxicity may be due to changes in calcium and NO signaling. © 2019 Elsevier Inc.

Biochemical and Biophysical Research Communications

Glyphosate induces toxicity and modulates calcium and NO signaling in zebrafish embryos

Repair of DNA alkylation damage is essential for maintaining genome integrity and Fe(II)/2-oxoglutarate(2OG)-dependent dioxygenase family of enzymes play crucial role in repairing some of the alkylation damages. Alkylation repair protein-B (AlkB) of Escherichia coli belongs to Fe(II)/2OG-dependent dioxygenase family and carries out DNA dealkylation repair. We report here identification of a hypothetical Mycobacterium leprae protein (accession no. ML0190) from the genomic database and show that this 615-bp open reading frame encodes a protein with sequence and structural similarity to Fe(II)/2OG-dependent dioxygenase AlkB. We identified mRNA transcript of this gene in the M. leprae infected clinical skin biopsy samples isolated from the leprosy patients. Heterologous expression of ML0190 in methyl methane sulfonate (MMS) sensitive and DNA repair deficient strain of Saccharomyces cerevisiae and Escherichia coli resulted in resistance to alkylating agent MM. The results of the present study imply that Mycobacterium leprae ML0190 is involved in protecting the bacterial genome from DNA alkylation damage. © 2019 Elsevier Inc.

Heteroexpression of Mycobacterium leprae hypothetical protein ML0190 provides protection against DNA-alkylating agent methyl methanesulfonate

Pore functionalization has been explored by several groups as a strategy to control DNA translocation through solid-state nanopores. Here we present a hybrid nanopore system consisting of single-layer graphene and a DNA origami layer to achieve base-selective control of DNA translocation rate through aligned nanopores of the two layers. This is achieved by incorporating unpaired dangling bases called overhangs to the origami near the pore region. Molecular dynamics simulations were used to optimize the design of the origami nanopore and the overhangs. Specifically, we considered the influence of the number and spatial distribution of overhangs on translocation times. The simulations revealed that specific interactions between the overhangs and the translocating single-stranded DNA resulted in base-specific residence times. © 2019 American Chemical Society.